ID: 1147537397_1147537412

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1147537397 1147537412
Species Human (GRCh38) Human (GRCh38)
Location 17:41329474-41329496 17:41329524-41329546
Sequence CCCTGGGATGGCACCATTTCCCA GGCTGACCACACTGCGGAAGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 26, 4: 235} {0: 1, 1: 0, 2: 0, 3: 9, 4: 126}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
27 17:16879807-16879829 CCTTCTCCACAGTGTGGGCAGCC - 17:16879857-16879879 TGGGAAACAGTGCCAGCCCAGGG +
27 17:20998326-20998348 CCCTGGACTGGCACCATTTCCCA - 17:20998376-20998398 GGCTGCCCACACTGTGGAGAGGG +
27 17:41329474-41329496 CCCTGGGATGGCACCATTTCCCA - 17:41329524-41329546 GGCTGACCACACTGCGGAAGGGG +
163 9:35818853-35818875 CCCTGGAATGGCCCCCTGTCCCA - 9:35819039-35819061 TAGGAAATGGTGGTATCCCCAGG +