ID: 1147537398_1147537412

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1147537398 1147537412
Species Human (GRCh38) Human (GRCh38)
Location 17:41329475-41329497 17:41329524-41329546
Sequence CCTGGGATGGCACCATTTCCCAG GGCTGACCACACTGCGGAAGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 39, 4: 278} {0: 1, 1: 0, 2: 0, 3: 9, 4: 126}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
26 17:20998327-20998349 CCTGGACTGGCACCATTTCCCAG - 17:20998376-20998398 GGCTGCCCACACTGTGGAGAGGG +
26 17:16923117-16923139 CCCCCTCCACAGTGTGGGCGGCC - 17:16923166-16923188 CTGGGAAATGGTGCCGGCCCAGG +
26 17:16879807-16879829 CCTTCTCCACAGTGTGGGCAGCC - 17:16879856-16879878 GTGGGAAACAGTGCCAGCCCAGG +
26 17:41329475-41329497 CCTGGGATGGCACCATTTCCCAG - 17:41329524-41329546 GGCTGACCACACTGCGGAAGGGG +