ID: 1147538045_1147538046

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1147538045 1147538046
Species Human (GRCh38) Human (GRCh38)
Location 17:41333677-41333699 17:41333699-41333721
Sequence CCTCAGGATCATTGTGAGGATGT TCACCTACATGATTTGCTCATGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 0, 3: 12, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!