ID: 1147546629_1147546630

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1147546629 1147546630
Species Human (GRCh38) Human (GRCh38)
Location 17:41406944-41406966 17:41406968-41406990
Sequence CCTTAGTGCTTAAAGGGGTATAT AGCCCTCTGATGCTTTTCACAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 2, 3: 5, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!