ID: 1147566611_1147566616

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1147566611 1147566616
Species Human (GRCh38) Human (GRCh38)
Location 17:41540346-41540368 17:41540370-41540392
Sequence CCTACCTCCAGCAGTTTATATAG TCAGAAAACTGAGAGAGAGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 38, 4: 453}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!