ID: 1147572094_1147572104

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1147572094 1147572104
Species Human (GRCh38) Human (GRCh38)
Location 17:41577621-41577643 17:41577663-41577685
Sequence CCTGAGGTGGGAACAAGCAAAGT CTGTGTGGCTAAAGGGCAGTGGG
Strand - +
Off-target summary No data {0: 3, 1: 0, 2: 2, 3: 23, 4: 193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!