ID: 1147586590_1147586608

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1147586590 1147586608
Species Human (GRCh38) Human (GRCh38)
Location 17:41656731-41656753 17:41656781-41656803
Sequence CCACAAGGAACACAGGAGTGTGG GGCCAAAAGATGGCGGGGCAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!