ID: 1147589450_1147589453

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1147589450 1147589453
Species Human (GRCh38) Human (GRCh38)
Location 17:41672313-41672335 17:41672339-41672361
Sequence CCCTGGGTTTCTATGTAAGTAAA AAACCCATCTCAGTATAGATGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 10, 3: 30, 4: 250} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!