ID: 1147605164_1147605176

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1147605164 1147605176
Species Human (GRCh38) Human (GRCh38)
Location 17:41770315-41770337 17:41770341-41770363
Sequence CCTCTCTAGCTTCCATCCCCTGG GGTCTGGGAGTCCCACAGGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 27, 4: 331} {0: 1, 1: 0, 2: 0, 3: 9, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!