|
Left Crispr |
Right Crispr |
| Crispr ID |
1147623164 |
1147623166 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:41881688-41881710
|
17:41881709-41881731
|
| Sequence |
CCAGGTTCAAGCAATTCTCCTGC |
GCCTCAGCCTCCCGAGTAGCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 30902, 1: 81215, 2: 152545, 3: 104312, 4: 56422} |
{0: 94911, 1: 257638, 2: 218586, 3: 135882, 4: 139272} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|