ID: 1147642642_1147642648

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1147642642 1147642648
Species Human (GRCh38) Human (GRCh38)
Location 17:42013678-42013700 17:42013727-42013749
Sequence CCAGGACACATGAAAAACATAAA CTCCATCCCATTTTCAGCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 394} {0: 1, 1: 0, 2: 4, 3: 44, 4: 391}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!