ID: 1147646139_1147646148

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1147646139 1147646148
Species Human (GRCh38) Human (GRCh38)
Location 17:42035248-42035270 17:42035291-42035313
Sequence CCAGAGTGCCCTGCATGTTTCTG GTGATCACCTTGGCATCTCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 277} {0: 1, 1: 0, 2: 2, 3: 18, 4: 139}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!