ID: 1147659796_1147659808

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1147659796 1147659808
Species Human (GRCh38) Human (GRCh38)
Location 17:42111462-42111484 17:42111498-42111520
Sequence CCTGAACTCTTCACCATGCTGGG CTGGGGGTGGAGAATGAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 167} {0: 1, 1: 0, 2: 5, 3: 49, 4: 548}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!