ID: 1147664704_1147664712

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1147664704 1147664712
Species Human (GRCh38) Human (GRCh38)
Location 17:42139161-42139183 17:42139204-42139226
Sequence CCATGGATCTGCTAGCACAGCTT GCTGTCCACAGAAGGGCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 6, 4: 134} {0: 1, 1: 0, 2: 3, 3: 17, 4: 233}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!