ID: 1147666586_1147666589

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1147666586 1147666589
Species Human (GRCh38) Human (GRCh38)
Location 17:42152694-42152716 17:42152734-42152756
Sequence CCTTGATCTCGGGAGGCAGAGGC GTGCCACTGCACTCCAGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 60, 3: 957, 4: 9355} {0: 52453, 1: 149973, 2: 210600, 3: 182318, 4: 112095}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!