|
Left Crispr |
Right Crispr |
Crispr ID |
1147666586 |
1147666592 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
17:42152694-42152716
|
17:42152747-42152769
|
Sequence |
CCTTGATCTCGGGAGGCAGAGGC |
CCAGCCTGGGTGACAAAACAAGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 3, 2: 60, 3: 957, 4: 9355} |
{0: 2, 1: 135, 2: 1088, 3: 2737, 4: 5117} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|