ID: 1147705204_1147705215

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1147705204 1147705215
Species Human (GRCh38) Human (GRCh38)
Location 17:42421467-42421489 17:42421483-42421505
Sequence CCCCCCTGCCCCACACGATCCCG GATCCCGCCTCCCTGGGGTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 271} {0: 1, 1: 0, 2: 2, 3: 7, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!