|
Left Crispr |
Right Crispr |
Crispr ID |
1147710696 |
1147710706 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
17:42462070-42462092
|
17:42462120-42462142
|
Sequence |
CCGGATGTGGTGGCACATGGCTG |
TGGGAGGATCGCTGAAGCCCAGG |
Strand |
- |
+ |
Off-target summary |
{0: 3, 1: 367, 2: 5465, 3: 23610, 4: 66981} |
{0: 9, 1: 362, 2: 5645, 3: 30290, 4: 65889} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|