ID: 1147710702_1147710706

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1147710702 1147710706
Species Human (GRCh38) Human (GRCh38)
Location 17:42462098-42462120 17:42462120-42462142
Sequence CCAGCTGCTTGGGAAGCTAAGGT TGGGAGGATCGCTGAAGCCCAGG
Strand - +
Off-target summary {0: 5, 1: 170, 2: 3084, 3: 29059, 4: 146728} {0: 9, 1: 362, 2: 5645, 3: 30290, 4: 65889}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!