ID: 1147720441_1147720445

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1147720441 1147720445
Species Human (GRCh38) Human (GRCh38)
Location 17:42536470-42536492 17:42536494-42536516
Sequence CCTGGGCGGCGGCGGCGCGGCGC CGTGCGGGTGCGCGGCTCCACGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 13, 3: 114, 4: 648} {0: 1, 1: 1, 2: 0, 3: 3, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!