ID: 1147721667_1147721671

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1147721667 1147721671
Species Human (GRCh38) Human (GRCh38)
Location 17:42543373-42543395 17:42543398-42543420
Sequence CCCTCATGGCTGAGCTGGGCTGG AAAGGACCCAGTGCCAGATTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 444} {0: 1, 1: 0, 2: 1, 3: 19, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!