ID: 1147744497_1147744509

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1147744497 1147744509
Species Human (GRCh38) Human (GRCh38)
Location 17:42687015-42687037 17:42687041-42687063
Sequence CCGTGCGGCGCCATTCCCGGATC TTCGAGGCCAGTGGGCAGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 20} {0: 1, 1: 0, 2: 1, 3: 22, 4: 258}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!