ID: 1147745381_1147745390

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1147745381 1147745390
Species Human (GRCh38) Human (GRCh38)
Location 17:42691525-42691547 17:42691566-42691588
Sequence CCCTTTTGTGTGCCCTCCCAGAG AAATCTAGGCCGCATGTCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 188} {0: 1, 1: 0, 2: 1, 3: 4, 4: 54}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!