ID: 1147745382_1147745387

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1147745382 1147745387
Species Human (GRCh38) Human (GRCh38)
Location 17:42691526-42691548 17:42691552-42691574
Sequence CCTTTTGTGTGCCCTCCCAGAGC CTCTCCAGTTTCCAAAATCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 202} {0: 1, 1: 0, 2: 2, 3: 20, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!