ID: 1147745386_1147745394

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1147745386 1147745394
Species Human (GRCh38) Human (GRCh38)
Location 17:42691542-42691564 17:42691581-42691603
Sequence CCAGAGCTGACTCTCCAGTTTCC GTCACTGGTGGTCTCTAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 239} {0: 1, 1: 0, 2: 0, 3: 11, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!