ID: 1147749226_1147749232

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1147749226 1147749232
Species Human (GRCh38) Human (GRCh38)
Location 17:42718379-42718401 17:42718392-42718414
Sequence CCAGAACAAAGAGAAGGAAATGG AAGGAAATGGTGGCTGGGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 43, 4: 486} {0: 1, 1: 1, 2: 12, 3: 155, 4: 1250}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!