ID: 1147749226_1147749233

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1147749226 1147749233
Species Human (GRCh38) Human (GRCh38)
Location 17:42718379-42718401 17:42718400-42718422
Sequence CCAGAACAAAGAGAAGGAAATGG GGTGGCTGGGGATGGAAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 43, 4: 486} {0: 1, 1: 0, 2: 9, 3: 112, 4: 975}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!