ID: 1147752552_1147752561

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1147752552 1147752561
Species Human (GRCh38) Human (GRCh38)
Location 17:42745055-42745077 17:42745079-42745101
Sequence CCGCGGCCCCACCCCTGCGCCGT CCCCGCCCCGCGCCTCCTGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 61, 4: 456} {0: 1, 1: 0, 2: 3, 3: 35, 4: 276}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!