ID: 1147757489_1147757493

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1147757489 1147757493
Species Human (GRCh38) Human (GRCh38)
Location 17:42778657-42778679 17:42778688-42778710
Sequence CCCTGAAGCAGATGGTGTCATTC CAGACACAAATGCTAGGTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 340} {0: 1, 1: 0, 2: 0, 3: 16, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!