ID: 1147768481_1147768488

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1147768481 1147768488
Species Human (GRCh38) Human (GRCh38)
Location 17:42852147-42852169 17:42852172-42852194
Sequence CCGCTACTACGACAGCCTGGCCC CTGGAGGCCCAGTTTGAGGCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 5, 4: 106} {0: 2, 1: 0, 2: 3, 3: 25, 4: 304}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
2 17:42852147-42852169 CCGCTACTACGACAGCCTGGCCC - 17:42852172-42852194 CTGGAGGCCCAGTTTGAGGCCGG +
2 17:42868079-42868101 CCGCTACTATGACAGCCTGGCCC - 17:42868104-42868126 CTGGAGGCCCAGTTTGAGGCCGG +