ID: 1147771069_1147771076

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1147771069 1147771076
Species Human (GRCh38) Human (GRCh38)
Location 17:42868079-42868101 17:42868104-42868126
Sequence CCGCTACTATGACAGCCTGGCCC CTGGAGGCCCAGTTTGAGGCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 117} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!