ID: 1147782263_1147782275

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1147782263 1147782275
Species Human (GRCh38) Human (GRCh38)
Location 17:42952016-42952038 17:42952066-42952088
Sequence CCTGATGAATGATGATACAGCCC AACTTTTTGAGAGCAACTATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 73} {0: 1, 1: 0, 2: 2, 3: 18, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!