ID: 1147805108_1147805118

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1147805108 1147805118
Species Human (GRCh38) Human (GRCh38)
Location 17:43125695-43125717 17:43125736-43125758
Sequence CCTATTGTCCAAAGCAGTCGTAA CACTCTTTCCGCCCTAATGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 144} {0: 2, 1: 0, 2: 0, 3: 6, 4: 47}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!