ID: 1147811117_1147811124

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1147811117 1147811124
Species Human (GRCh38) Human (GRCh38)
Location 17:43170544-43170566 17:43170577-43170599
Sequence CCAAAGCAGTCTTAAGAAGAGGT CACTCTTTCCGCCCTAATGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 18, 4: 178} {0: 2, 1: 0, 2: 0, 3: 6, 4: 47}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!