ID: 1147817953_1147817964

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1147817953 1147817964
Species Human (GRCh38) Human (GRCh38)
Location 17:43223877-43223899 17:43223930-43223952
Sequence CCCCACCTCCTCTGTCACGCTTA CACTCTCTGCAGAAGTTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 189} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!