ID: 1147817955_1147817964

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1147817955 1147817964
Species Human (GRCh38) Human (GRCh38)
Location 17:43223879-43223901 17:43223930-43223952
Sequence CCACCTCCTCTGTCACGCTTACT CACTCTCTGCAGAAGTTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 267} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!