ID: 1147832912_1147832918

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1147832912 1147832918
Species Human (GRCh38) Human (GRCh38)
Location 17:43309715-43309737 17:43309763-43309785
Sequence CCTGTCTCAAAAAAAAAAAAAAA AGTGTGGTCACTTGGAAGCCTGG
Strand - +
Off-target summary {0: 13279, 1: 16490, 2: 27851, 3: 54067, 4: 109329} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!