ID: 1147859176_1147859184

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1147859176 1147859184
Species Human (GRCh38) Human (GRCh38)
Location 17:43507126-43507148 17:43507176-43507198
Sequence CCCAGAAGAGTGGCAGCTATGTC TGGTTGTTGCTTAGGCCAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 151} {0: 1, 1: 0, 2: 0, 3: 8, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!