ID: 1147862799_1147862806

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1147862799 1147862806
Species Human (GRCh38) Human (GRCh38)
Location 17:43533408-43533430 17:43533434-43533456
Sequence CCTTCATTCCTAGGAAAGCGAGG CAGGGATTACAGGAGAAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 93} {0: 1, 1: 0, 2: 7, 3: 51, 4: 450}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!