ID: 1147879786_1147879799

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1147879786 1147879799
Species Human (GRCh38) Human (GRCh38)
Location 17:43646185-43646207 17:43646218-43646240
Sequence CCGGAGAAGGCAGGTCCAGACCC GGGAGCGTGGGCAGCAGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 232} {0: 1, 1: 0, 2: 9, 3: 128, 4: 1663}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!