ID: 1147880853_1147880859

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1147880853 1147880859
Species Human (GRCh38) Human (GRCh38)
Location 17:43652397-43652419 17:43652426-43652448
Sequence CCAGCCAGCATCAGGGGAGGACT AGAGAGGGGTGCTCATATGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 147} {0: 1, 1: 0, 2: 0, 3: 6, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!