ID: 1147899211_1147899219

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1147899211 1147899219
Species Human (GRCh38) Human (GRCh38)
Location 17:43773013-43773035 17:43773052-43773074
Sequence CCCAGCCTATGTTTACACAGGGT CTGGAGTGGAGGAGGTGAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 128} {0: 1, 1: 1, 2: 9, 3: 70, 4: 676}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!