ID: 1147900113_1147900120

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1147900113 1147900120
Species Human (GRCh38) Human (GRCh38)
Location 17:43778516-43778538 17:43778537-43778559
Sequence CCCCAAGCGGGTGGCGGCTGGGA GACCCGGGCAGGCGCCACCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 124} {0: 1, 1: 0, 2: 0, 3: 15, 4: 193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!