ID: 1147904878_1147904888

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1147904878 1147904888
Species Human (GRCh38) Human (GRCh38)
Location 17:43816295-43816317 17:43816335-43816357
Sequence CCTGAGGGGGATTCTAGGCCAGC GAGTGTGAGCAGTGTGAATAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 75} {0: 1, 1: 0, 2: 0, 3: 18, 4: 246}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!