ID: 1147911400_1147911408

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1147911400 1147911408
Species Human (GRCh38) Human (GRCh38)
Location 17:43858322-43858344 17:43858337-43858359
Sequence CCACCTCCAAGCCCGGCCTCCTG GCCTCCTGGCTCTGCGGGCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 100, 4: 907} {0: 1, 1: 0, 2: 2, 3: 37, 4: 303}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!