ID: 1147915589_1147915597

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1147915589 1147915597
Species Human (GRCh38) Human (GRCh38)
Location 17:43883393-43883415 17:43883418-43883440
Sequence CCCCAGGAGCCCTGGGACACCAA AGGGTCCTCCCTCAGCCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 48, 4: 262} {0: 1, 1: 0, 2: 6, 3: 61, 4: 591}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!