ID: 1147919153_1147919159

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1147919153 1147919159
Species Human (GRCh38) Human (GRCh38)
Location 17:43905945-43905967 17:43905976-43905998
Sequence CCCTATTCAGGCTACACCCAGGC ATGCCCAGGATCCACTGTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 119} {0: 1, 1: 0, 2: 1, 3: 10, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!