ID: 1147924676_1147924683

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1147924676 1147924683
Species Human (GRCh38) Human (GRCh38)
Location 17:43939021-43939043 17:43939064-43939086
Sequence CCCTGTAGTTTCTGCTGTGAGAG GGGTCCTCCCCTGCCTCCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 208} {0: 1, 1: 0, 2: 11, 3: 62, 4: 597}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!