ID: 1147930715_1147930725

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1147930715 1147930725
Species Human (GRCh38) Human (GRCh38)
Location 17:43978851-43978873 17:43978889-43978911
Sequence CCCTCCATACTCTGCATCAGAAG CGGTCTAACCCTTAAACTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 194} {0: 1, 1: 0, 2: 0, 3: 2, 4: 32}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!