ID: 1147935358_1147935371

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1147935358 1147935371
Species Human (GRCh38) Human (GRCh38)
Location 17:44007639-44007661 17:44007684-44007706
Sequence CCCGTACCTGGACAAATTTGTGG AGGCTCCGGCCAGATGCTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 105} {0: 1, 1: 0, 2: 4, 3: 11, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!